TY - JOUR
T1 - A Description of Conformational Transitions in the Pribnow Box of the trp Promoter of Escherichia coli
AU - Lefévre, Jean Francis
AU - Lane, Andrew N.
AU - Jardetzky, Oleg
PY - 1988/2/1
Y1 - 1988/2/1
N2 - Selective changes in the NMR parameters of the sequence of CGTACTAGTTAACTAGTACG, which corresponds to the trp operator of Escherichia coli, were observed as a function of temperature. The changes were localized to the sequence TTAA in the Pribnow box (underlined). Differential changes in chemical shift were analyzed in terms of a three-state model (states I, II, and III) to give the equilibrium constants, enthalpy changes, and populations. The midpoints of the first and second transitions were 9 and 30 °C, with enthalpy changes of 58 and 35 kcal/mol, respectively. Measurement of the spin-lattice and cross-relaxation rate constants at different temperatures allowed some structural conclusions to be drawn about the nature of the transitions. The line width of the H2 of A11 goes through a maximum at about 30 °C, indicating moderately fast exchange between the states. The rate constants for exchange at the midpoints were about 200 (I ↔ II) and 250 (II↔ III) s-1. Taking these findings into account, we propose a mechanism for the interaction between RNA polymerase and the promoter. This mechanism can explain the temperature dependence observed for the initiation of transcription.
AB - Selective changes in the NMR parameters of the sequence of CGTACTAGTTAACTAGTACG, which corresponds to the trp operator of Escherichia coli, were observed as a function of temperature. The changes were localized to the sequence TTAA in the Pribnow box (underlined). Differential changes in chemical shift were analyzed in terms of a three-state model (states I, II, and III) to give the equilibrium constants, enthalpy changes, and populations. The midpoints of the first and second transitions were 9 and 30 °C, with enthalpy changes of 58 and 35 kcal/mol, respectively. Measurement of the spin-lattice and cross-relaxation rate constants at different temperatures allowed some structural conclusions to be drawn about the nature of the transitions. The line width of the H2 of A11 goes through a maximum at about 30 °C, indicating moderately fast exchange between the states. The rate constants for exchange at the midpoints were about 200 (I ↔ II) and 250 (II↔ III) s-1. Taking these findings into account, we propose a mechanism for the interaction between RNA polymerase and the promoter. This mechanism can explain the temperature dependence observed for the initiation of transcription.
UR - http://www.scopus.com/inward/record.url?scp=0024295001&partnerID=8YFLogxK
UR - http://www.scopus.com/inward/citedby.url?scp=0024295001&partnerID=8YFLogxK
U2 - 10.1021/bi00404a002
DO - 10.1021/bi00404a002
M3 - Article
C2 - 3284577
AN - SCOPUS:0024295001
SN - 0006-2960
VL - 27
SP - 1086
EP - 1094
JO - Biochemistry
JF - Biochemistry
IS - 4
ER -