A Description of Conformational Transitions in the Pribnow Box of the trp Promoter of Escherichia coli

Jean Francis Lefévre, Andrew N. Lane, Oleg Jardetzky

Research output: Contribution to journalArticlepeer-review

26 Scopus citations

Abstract

Selective changes in the NMR parameters of the sequence of CGTACTAGTTAACTAGTACG, which corresponds to the trp operator of Escherichia coli, were observed as a function of temperature. The changes were localized to the sequence TTAA in the Pribnow box (underlined). Differential changes in chemical shift were analyzed in terms of a three-state model (states I, II, and III) to give the equilibrium constants, enthalpy changes, and populations. The midpoints of the first and second transitions were 9 and 30 °C, with enthalpy changes of 58 and 35 kcal/mol, respectively. Measurement of the spin-lattice and cross-relaxation rate constants at different temperatures allowed some structural conclusions to be drawn about the nature of the transitions. The line width of the H2 of A11 goes through a maximum at about 30 °C, indicating moderately fast exchange between the states. The rate constants for exchange at the midpoints were about 200 (I ↔ II) and 250 (II↔ III) s-1. Taking these findings into account, we propose a mechanism for the interaction between RNA polymerase and the promoter. This mechanism can explain the temperature dependence observed for the initiation of transcription.

Original languageEnglish
Pages (from-to)1086-1094
Number of pages9
JournalBiochemistry
Volume27
Issue number4
DOIs
StatePublished - Feb 1 1988

Funding

FundersFunder number
National Institute of General Medical SciencesR01GM033385

    ASJC Scopus subject areas

    • Biochemistry

    Fingerprint

    Dive into the research topics of 'A Description of Conformational Transitions in the Pribnow Box of the trp Promoter of Escherichia coli'. Together they form a unique fingerprint.

    Cite this