TY - JOUR
T1 - Erratum
T2 - Oncogenic Role of Fusion-circRNAs Derived from Cancer-Associated Chromosomal Translocations (Cell (2016) 165(2) (289–302))
AU - Guarnerio, Jlenia
AU - Bezzi, Marco
AU - Jeong, Jong Cheol
AU - Paffenholz, Stella V.
AU - Berry, Kelsey
AU - Naldini, Matteo M.
AU - Lo-Coco, Francesco
AU - Tay, Yvonne
AU - Beck, Andrew H.
AU - Pandolfi, Pier Paolo
N1 - Publisher Copyright:
© 2016 Elsevier Inc.
PY - 2016/8/11
Y1 - 2016/8/11
N2 - (Cell 165, 289–302; April 7, 2016) In the above article, which identifies circular RNAs derived from cancer-associated chromosomal translocations and shows their tumor-promoting properties, there is a duplicated plot panel in Figure 5. This figure analyzes the role of the endogenous circular RNA f-circM9 in the maintenance of cancer cells. In panel 5G, which demonstrates that the knockdown of the endogenous f-circM9s in THP1 cells affects their survival, the plot showing the number of cells undergoing apoptosis upon treatment with shCircPR1 has been inadvertently replaced with the plot belonging to the cells treated with the shSCR shRNA. The quantitation shown in the chart in Figure 5G is correct, as it refers to the correct plot. The oversight on the plot panel was encountered only during assembly of the final panel of the figure. The panel has been corrected online and appears below; it supports the original conclusions that shCircPR1 does not affect the survival of the THP1 cells. In addition, the sequence of the primers spanning the junction of the circM9_1, listed in Table S4, was determined to be incorrect. The correct primers are: Fw: CCAGGCAACAAGCTGTGAAAA; Rv: CTCTTTTCCTCGACGGGCTT. Table S4 has also been corrected online, and we apologize for any confusion that these errors may have caused.
AB - (Cell 165, 289–302; April 7, 2016) In the above article, which identifies circular RNAs derived from cancer-associated chromosomal translocations and shows their tumor-promoting properties, there is a duplicated plot panel in Figure 5. This figure analyzes the role of the endogenous circular RNA f-circM9 in the maintenance of cancer cells. In panel 5G, which demonstrates that the knockdown of the endogenous f-circM9s in THP1 cells affects their survival, the plot showing the number of cells undergoing apoptosis upon treatment with shCircPR1 has been inadvertently replaced with the plot belonging to the cells treated with the shSCR shRNA. The quantitation shown in the chart in Figure 5G is correct, as it refers to the correct plot. The oversight on the plot panel was encountered only during assembly of the final panel of the figure. The panel has been corrected online and appears below; it supports the original conclusions that shCircPR1 does not affect the survival of the THP1 cells. In addition, the sequence of the primers spanning the junction of the circM9_1, listed in Table S4, was determined to be incorrect. The correct primers are: Fw: CCAGGCAACAAGCTGTGAAAA; Rv: CTCTTTTCCTCGACGGGCTT. Table S4 has also been corrected online, and we apologize for any confusion that these errors may have caused.
UR - https://www.scopus.com/pages/publications/84981308322
UR - https://www.scopus.com/inward/citedby.url?scp=84981308322&partnerID=8YFLogxK
U2 - 10.1016/j.cell.2016.07.035
DO - 10.1016/j.cell.2016.07.035
M3 - Comment/debate
AN - SCOPUS:84981308322
SN - 0092-8674
VL - 166
SP - 1055
EP - 1056
JO - Cell
JF - Cell
IS - 4
ER -