The crystal structure of the Yersinia pestis iron chaperone YiuA reveals a basic triad binding motif for the chelated metal

Christopher D. Radka; Dongquan Chen; Lawrence J. Delucas; Stephen G. Aller

doi:10.1107/S2059798317015236

The crystal structure of the Yersinia pestis iron chaperone YiuA reveals a basic triad binding motif for the chelated metal

Christopher D. Radka
, Dongquan Chen
, Lawrence J. Delucas
, Stephen G. Aller

Research output: Contribution to journal › Article › peer-review

9 Scopus citations

Abstract

Biological chelating molecules called siderophores are used to sequester iron and maintain its ferric state. Bacterial substrate-binding proteins (SBPs) bind iron-siderophore complexes and deliver these complexes to ATP-binding cassette (ABC) transporters for import into the cytoplasm, where the iron can be transferred from the siderophore to catalytic enzymes. In Yersinia pestis, the causative agent of plague, the Yersinia iron-uptake (Yiu) ABC transporter has been shown to improve iron acquisition under iron-chelated conditions. The Yiu transporter has been proposed to be an iron-siderophore transporter; however, the precise siderophore substrate is unknown. Therefore, the precise role of the Yiu transporter in Y. pestis survival remains uncharacterized. To better understand the function of the Yiu transporter, the crystal structure of YiuA (YPO1310/y2875), an SBP which functions to present the iron-siderophore substrate to the transporter for import into the cytoplasm, was determined. The 2.20 and 1.77Å resolution X-ray crystal structures reveal a basic triad binding motif at the YiuA canonical substrate-binding site, indicative of a metal-chelate binding site. Structural alignment and computational docking studies support the function of YiuA in binding chelated metal. Additionally, YiuA contains two mobile helices, helix 5 and helix 10, that undergo 2-3Å shifts across crystal forms and demonstrate structural breathing of the c-clamp architecture. The flexibility in both c-clamp lobes suggest that YiuA substrate transfer resembles the Venus flytrap mechanism that has been proposed for other SBPs.YiuA, a Yersinia pestis substrate-binding protein, contains a putative basic triad binding motif in the canonical substrate-binding site, indicative of a metal-chelate complex binding site. Additional structural and simulation analyses support the putative function of YiuA binding bacterial siderophores.

Original language	English
Pages (from-to)	921-939
Number of pages	19
Journal	Acta Crystallographica Section D: Structural Biology
Volume	73
Issue number	11
DOIs	https://doi.org/10.1107/S2059798317015236
State	Published - Nov 2017

Bibliographical note

Publisher Copyright:
© Radka et al. 2017.

Funding

Transcription-factor binding site (TFBS) predictions in Hmu, Yfu, Yfe and Yiu promoters. PMW (species) indicates the transcription factor that was detected and the species from which the TFBS sequence was determined. Start and end positions indicate the positions in the promoter containing the TFBS. Strand indicates which strand contains the TFBS. Score indicates a similarity score between the promoter and the TFBS position weight matrix. Sequence indicates the nucleotides in the promoter that correspond to the TFBS. PWM (species) Start position End position Strand Score Sequence Hmu OxyR (SELEX) | E. coli (strain K12) 2 47 − 13.62 ACAAAATGGATTACCGGATGAATGATTTCAGACTAACTTTTTTTCA CspA | E. coli (strain K12) 95 99 + 10 CCAAT GcvA | E. coli (strain K12) 102 106 − 10 CTAAT Yfu OxyR (SELEX) | E. coli (strain K12) 190 235 + 13.44 GAAATATTCAGATAACAATGATAATCATTTTTATTACCATAATTCG OxyR (SELEX) | E. coli (strain K12) 39 84 − 13.17 ATTATATGAAGAGTACCGGCTTTAACGGCATTTTCCTGTTTGTTCA CspA | E. coli (strain K12) 104 108 + 10 CCAAT GcvA | E. coli (strain K12) 175 179 − 10 CTAAT Yfe Fur (18-mer) | E. coli (strain K12) 170 187 − 28.77 AAAATGATTATCAATACC OmpR (C box)| E. coli (strain K12) 28 37 + 12.14 TGTAGCATAT CpxR | E. coli (strain K12) 113 128 + 12.13 AGTAACTATTGGTAAG CspA | E. coli (strain K12) 120 124 − 10 CCAAT GcvA | E. coli (strain K12) 165 169 + 10 CTAAT Ysu LexA | E. coli (strain K12) 33 48 + 10.45 TTGGCAAAAGATACAG Yiu OxyR (SELEX) | E. coli (strain K12) 27 72 − 13.61 TTGATAAGTATTATCATTTGCTTTATTGTTAGCGCCATCTTATGGG OxyR (SELEX) | E. coli (strain K12) 225 270 + 13.54 TTTATAGGCACTAAAGAAGGGCGATAGCGTTATCGCCCTTTCATCC OxyR (SELEX) | E. coli (strain K12) 152 197 − 13.4 ACGAAATGTGCTGGTATTGGCGCATTCTATCCGTGAACATCAGGCT CpxR | E. coli (strain K12) 96 111 + 12.66 CGTAACTTTTTGTAAG CpxR | E. coli (strain K12) 86 101 + 12.26 AGTAATTGGACGTAAC LexA | E. coli (strain K12) 199 214 − 10.47 CTGACGCCAATACCAG FhlA | E. coli (strain K12) 191 197 + 10.24 ATTTCGT CspA | E. coli (strain K12) 204 208 − 10 CCAAT CspA | E. coli (strain K12) 178 182 + 10 CCAAT CspA | E. coli (strain K12) 130 134 − 10 CCAAT GcvA | E. coli (strain K12) 221 225 + 10 CTAAT GcvA | E. coli (strain K12) 145 149 + 10 CTAAT Data were collected at GM/CA@APS, which has been funded in whole or in part with Federal funds from the National Cancer Institute (ACB-12002) and the National Institute of General Medical Sciences (AGM-12006). This research used the resources of the Advanced Photon Source (APS), a US Department of Energy (DOE) Office of Science User Facility operated for the DOE Office of Science by Argonne National Laboratory under Contract No. DE-AC02-06CH11357. Use of the Advanced Photon Source was supported by the US Department of Energy, Office of Science, Office of Basic Energy Sciences under Contract No. W-31-109-Eng-38. The authors are grateful to Dr Robert Perry for generously providing the pYIU3 plasmid for this work. This publication was made possible by a Research Voucher from the UAB Center for Clinical and Translational Science (CCTS) Grant No. UL1TR001417 from the National Center for Advancing Translational Sciences (NCATS) of the National Institutes of Health (NIH). DC was supported by UAB CCTS Grant No. UL1TR001417 from the NCATS of the NIH. Author contributions are as follows. Conceptualization: CDR, LJD and SGA; methodology, CDR, LDJ and SGA; investigation, CDR, DC and SGA; writing, original draft, CDR; writing, review and editing, CDR, DC, LJD and SGA; visualization, CDR; funding acquisition, CDR, LDJ and SGA; resources, LJD and SGA; supervision, LJD and SGA. The authors declare that they have no competing interests.

Funders	Funder number
99
ACAAAATGGATTACCGGATGAATGATTTCAGACTAACTTTTTTTCA
ATTATATGAAGAGTACCGGCTTTAACGGCATTTTCCTGTTTGTTCA
CTGACGCCAATACCAG
US DOE Office of Science
Office of Science User Facility operated
UAB CCTS
US Department of Energy
National Institutes of Health (NIH)
U.S. Department of Energy EPSCoR
National Childhood Cancer Registry – National Cancer Institute	ACB-12002
National Childhood Cancer Registry – National Cancer Institute
National Institute of General Medical Sciences	APS, AGM-12006
National Institute of General Medical Sciences
National Center for Advancing Translational Sciences (NCATS)
DOE Basic Energy Sciences
Argonne National Laboratory
Center for Clinical and Translational Science, University of Utah	UL1TR001417
Center for Clinical and Translational Science, University of Utah
Center for Clinical and Translational Science, Mayo Clinic

Keywords

X-ray crystallography
Yersinia pestis
YiuA
docking
plague
substrate-binding protein (SBP)
transition-metal homeostasis

ASJC Scopus subject areas

Structural Biology

Access to Document

10.1107/S2059798317015236

Cite this

@article{ae84d557cafb4425a35bb9d48b1377ad,

title = "The crystal structure of the Yersinia pestis iron chaperone YiuA reveals a basic triad binding motif for the chelated metal",

abstract = "Biological chelating molecules called siderophores are used to sequester iron and maintain its ferric state. Bacterial substrate-binding proteins (SBPs) bind iron-siderophore complexes and deliver these complexes to ATP-binding cassette (ABC) transporters for import into the cytoplasm, where the iron can be transferred from the siderophore to catalytic enzymes. In Yersinia pestis, the causative agent of plague, the Yersinia iron-uptake (Yiu) ABC transporter has been shown to improve iron acquisition under iron-chelated conditions. The Yiu transporter has been proposed to be an iron-siderophore transporter; however, the precise siderophore substrate is unknown. Therefore, the precise role of the Yiu transporter in Y. pestis survival remains uncharacterized. To better understand the function of the Yiu transporter, the crystal structure of YiuA (YPO1310/y2875), an SBP which functions to present the iron-siderophore substrate to the transporter for import into the cytoplasm, was determined. The 2.20 and 1.77{\AA} resolution X-ray crystal structures reveal a basic triad binding motif at the YiuA canonical substrate-binding site, indicative of a metal-chelate binding site. Structural alignment and computational docking studies support the function of YiuA in binding chelated metal. Additionally, YiuA contains two mobile helices, helix 5 and helix 10, that undergo 2-3{\AA} shifts across crystal forms and demonstrate structural breathing of the c-clamp architecture. The flexibility in both c-clamp lobes suggest that YiuA substrate transfer resembles the Venus flytrap mechanism that has been proposed for other SBPs.YiuA, a Yersinia pestis substrate-binding protein, contains a putative basic triad binding motif in the canonical substrate-binding site, indicative of a metal-chelate complex binding site. Additional structural and simulation analyses support the putative function of YiuA binding bacterial siderophores.",

keywords = "X-ray crystallography, Yersinia pestis, YiuA, docking, plague, substrate-binding protein (SBP), transition-metal homeostasis",

author = "Radka, \{Christopher D.\} and Dongquan Chen and Delucas, \{Lawrence J.\} and Aller, \{Stephen G.\}",

note = "Publisher Copyright: {\textcopyright} Radka et al. 2017.",

year = "2017",

month = nov,

doi = "10.1107/S2059798317015236",

language = "English",

volume = "73",

pages = "921--939",

number = "11",

}

TY - JOUR

T1 - The crystal structure of the Yersinia pestis iron chaperone YiuA reveals a basic triad binding motif for the chelated metal

AU - Radka, Christopher D.

AU - Chen, Dongquan

AU - Delucas, Lawrence J.

AU - Aller, Stephen G.

N1 - Publisher Copyright: © Radka et al. 2017.

PY - 2017/11

Y1 - 2017/11

N2 - Biological chelating molecules called siderophores are used to sequester iron and maintain its ferric state. Bacterial substrate-binding proteins (SBPs) bind iron-siderophore complexes and deliver these complexes to ATP-binding cassette (ABC) transporters for import into the cytoplasm, where the iron can be transferred from the siderophore to catalytic enzymes. In Yersinia pestis, the causative agent of plague, the Yersinia iron-uptake (Yiu) ABC transporter has been shown to improve iron acquisition under iron-chelated conditions. The Yiu transporter has been proposed to be an iron-siderophore transporter; however, the precise siderophore substrate is unknown. Therefore, the precise role of the Yiu transporter in Y. pestis survival remains uncharacterized. To better understand the function of the Yiu transporter, the crystal structure of YiuA (YPO1310/y2875), an SBP which functions to present the iron-siderophore substrate to the transporter for import into the cytoplasm, was determined. The 2.20 and 1.77Å resolution X-ray crystal structures reveal a basic triad binding motif at the YiuA canonical substrate-binding site, indicative of a metal-chelate binding site. Structural alignment and computational docking studies support the function of YiuA in binding chelated metal. Additionally, YiuA contains two mobile helices, helix 5 and helix 10, that undergo 2-3Å shifts across crystal forms and demonstrate structural breathing of the c-clamp architecture. The flexibility in both c-clamp lobes suggest that YiuA substrate transfer resembles the Venus flytrap mechanism that has been proposed for other SBPs.YiuA, a Yersinia pestis substrate-binding protein, contains a putative basic triad binding motif in the canonical substrate-binding site, indicative of a metal-chelate complex binding site. Additional structural and simulation analyses support the putative function of YiuA binding bacterial siderophores.

AB - Biological chelating molecules called siderophores are used to sequester iron and maintain its ferric state. Bacterial substrate-binding proteins (SBPs) bind iron-siderophore complexes and deliver these complexes to ATP-binding cassette (ABC) transporters for import into the cytoplasm, where the iron can be transferred from the siderophore to catalytic enzymes. In Yersinia pestis, the causative agent of plague, the Yersinia iron-uptake (Yiu) ABC transporter has been shown to improve iron acquisition under iron-chelated conditions. The Yiu transporter has been proposed to be an iron-siderophore transporter; however, the precise siderophore substrate is unknown. Therefore, the precise role of the Yiu transporter in Y. pestis survival remains uncharacterized. To better understand the function of the Yiu transporter, the crystal structure of YiuA (YPO1310/y2875), an SBP which functions to present the iron-siderophore substrate to the transporter for import into the cytoplasm, was determined. The 2.20 and 1.77Å resolution X-ray crystal structures reveal a basic triad binding motif at the YiuA canonical substrate-binding site, indicative of a metal-chelate binding site. Structural alignment and computational docking studies support the function of YiuA in binding chelated metal. Additionally, YiuA contains two mobile helices, helix 5 and helix 10, that undergo 2-3Å shifts across crystal forms and demonstrate structural breathing of the c-clamp architecture. The flexibility in both c-clamp lobes suggest that YiuA substrate transfer resembles the Venus flytrap mechanism that has been proposed for other SBPs.YiuA, a Yersinia pestis substrate-binding protein, contains a putative basic triad binding motif in the canonical substrate-binding site, indicative of a metal-chelate complex binding site. Additional structural and simulation analyses support the putative function of YiuA binding bacterial siderophores.

KW - X-ray crystallography

KW - Yersinia pestis

KW - YiuA

KW - docking

KW - plague

KW - substrate-binding protein (SBP)

KW - transition-metal homeostasis

UR - https://www.scopus.com/pages/publications/85032743171

UR - https://www.scopus.com/pages/publications/85032743171#tab=citedBy

U2 - 10.1107/S2059798317015236

DO - 10.1107/S2059798317015236

M3 - Article

C2 - 29095164

AN - SCOPUS:85032743171

SN - 0907-4449

VL - 73

SP - 921

EP - 939

JO - Acta Crystallographica Section D: Structural Biology

JF - Acta Crystallographica Section D: Structural Biology

IS - 11

ER -

The crystal structure of the Yersinia pestis iron chaperone YiuA reveals a basic triad binding motif for the chelated metal

Abstract

Bibliographical note

Funding

Keywords

ASJC Scopus subject areas

Access to Document

Other files and links

Fingerprint

Cite this